From a Html file a tag was extracted
from bs4 import BeautifulSoup
html=open("centrimo.html")
parsed_html=BeautifulSoup(html)
script_data=parsed_cen.script
Now from the string contained in the script tag I would like to extract the information in the variables "sequences", "neg_sequences", "seqs" and "nseqs".
<script type="text/javascript">
//@JSON_VAR data
var data = {
"version": "5.3.3",
"revision": "1667d7719daf2af1693cc039ba463bc4d2304d23",
"release": "Sun Feb 7 15:39:52 2021 -0800",
"program": "CentriMo",
"options": {
"cd": false,
"neg_sequences": true,
"noseq": false,
"mcc": false
},
"seqlen": 101,
"tested": 435,
"alphabet": {
"name": "DNA",
"like": "dna",
"ncore": 4
},
"background": [0.2788, 0.2212, 0.2212, 0.2788],
"sequences": [
"AT1G04100.1_CDS", "AT1G05860.1_CDS", "AT1G13910.1_CDS",
"AT1G21065.1_CDS", "AT1G26190.1_CDS", "AT1G32940.1_CDS",
"AT1G50575.1_CDS", "AT1G55810.1_CDS", "AT1G66430.1_CDS",
"AT1G71430.1_CDS", "AT1G77170.1_CDS", "AT1G78610.1_CDS",
"AT2G02955.1_CDS", "AT2G16280.1_CDS", "AT2G17080.1_CDS",
"AT2G19620.1_CDS", "AT2G19640.1_CDS", "AT2G30840.1_CDS",
"AT2G39450.1_CDS", "AT2G41380.1_CDS", "AT2G42580.1_CDS",
"AT3G01680.1_CDS", "AT3G05680.1_CDS", "AT3G20110.1_CDS",
"AT3G20260.1_CDS", "AT3G21360.1_CDS", "AT3G23070.1_CDS",
"AT3G23590.1_CDS", "AT3G46820.1_CDS", "AT3G48250.1_CDS",
"AT3G61200.1_CDS", "AT4G08510.1_CDS", "AT4G15070.1_CDS",
"AT4G24670.1_CDS", "AT4G25450.1_CDS", "AT4G28600.1_CDS",
"AT4G31910.1_CDS", "AT4G34810.1_CDS", "AT4G35030.3_CDS",
"AT4G37170.1_CDS", "AT4G38630.1_CDS", "AT4G39720.1_CDS",
"AT5G07340.1_CDS", "AT5G12970.1_CDS", "AT5G13470.1_CDS",
"AT5G18950.1_CDS", "AT5G22840.1_CDS", "AT5G25590.1_CDS",
"AT5G27395.1_CDS", "AT5G53370.1_CDS", "AT5G63610.1_CDS",
"AT5G64830.1_CDS", "AT5G64900.1_CDS", "AT5G67620.1_CDS"
],
"neg_sequences": [
"AT1G01600.1_CDS", "AT2G32480.1_CDS", "AT2G41740.1_CDS",
"AT3G19490.1_CDS", "AT3G24030.1_CDS", "AT3G25580.1_CDS",
"AT3G48330.1_CDS", "AT3G59220.1_CDS", "AT4G13340.1_CDS",
"AT4G33590.1_CDS", "AT5G03080.1_CDS", "AT5G23700.1_CDS",
"AT5G41010.1_CDS"
],
"motifs": [
{
"db": 2,
"id": "ath-miR419",
"alt": "MIMAT0001327",
"consensus": "CAACATCCTCAGCATTCATAA",
"len": 21,
"motif_evalue": "0.0e+000",
"motif_nsites": 20,
"n_tested": 40,
"score_threshold": 5,
"url": "http://www.mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0001327",
"pwm": [
[0.164036, 0.479478, 0.163749, 0.192738],
[0.479764, 0.163749, 0.192452, 0.164036]
],
"total_sites": 10,
"sites": [
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
],
"neg_total_sites": 2,
"neg_sites": [
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
],
"seqs": [0, 1, 13, 15, 16, 23, 27, 36, 44, 48],
"neg_seqs": [3, 10],
"peaks": [
{
"center": 0,
"fisher_log_adj_pvalue": 0
}
]
}
]
};
</script>
I tried to convert the object into a json type object but I got the following error,
import json
j_script = json.loads(script_data.string)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/lib/python3.7/json/__init__.py", line 348, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.7/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.7/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 2 column 7 (char 7)
Thanks in advance
PS. an example of a complete html file that I would like to parse can be found (here)
Edit: In the original post I mentioned that I got an indentation error. That happened after trying to manually edit the json object by removing all the white spaces, "\n" characters. Although I don't think it fundamentally changes the question, I apologize for the mistake
[UPDATE] I was able to adapt the answer in this post as follows
tmp=script_data.string.partition('=')
j_tmp=tmp[2].replace(";\n ","")
j_script=json.loads(j_tmp)
The second line is a bit clumsy (I couldn't adapt the answer in this other post) but overall it does the trick. Now I'm trying to obtain the 'seqs' data which is contained in the "motifs" list.
Help with the second line in the code above will be much appreciated
var data =and not just the object in the script_data string"version": "5.3.3"is"version": "5.3.2", etc.